ReviewFrontiers in oncology2025
A review on the role of MiR-193a-5p in oncogenesis and tumor progression.
Review in Frontiers in oncology, 2025. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 9 papers.
What it found
Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.
The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.
The trial behind it
Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.
Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.
Who cites it
9 citing papers in PubMed.
- MOTCS: A Cancer Subtype Classification and Key Biomarker Recognition Model Based on Multi-Omics Data Integration of Transformer.International journal of molecular sciences · 2026Article
- Predictive value of miR-193a-5p combined with VEGFB in the diagnosis and prognosis of CHD.Journal of cardiothoracic surgery · 2026Article
- Transcriptomic Profiling of MicroRNA and Non-Coding RNA from Whole Blood of African Americans with MASLD.International journal of molecular sciences · 2026Article
- Epigenetics in B-CLL.International journal of genomics · 2026Review
- Circ-MYO9B modulates metabolic pathways in nonalcoholic steatohepatitis via miR-193b-5p.Molecular biology reports · 2025Article
- Novel circulating microRNA signature for early detection and prognostication of checkpoint inhibitor-related pneumonitis.Journal for immunotherapy of cancer · 2025Article
- Transcriptomic Signatures of Mitochondrial Dysfunction in Autism: Integrated mRNA and microRNA Profiling.Genes · 2025Article
- Article
- miR-193a-3p prevents tumour progression by targeting TCL1 in diffuse large B-cell lymphoma.Journal of translational medicine · 2025Article
Corrections and comments
PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.
Authors and funding
4 authors.
Funding
No grant is acknowledged in the PubMed record.
Abstract
MicroRNA (miRNA), a class of short non-coding RNA molecules comprising 18-25 nucleotides, are pivotal regulators of gene expression within physiological environments, influencing processes such as cell growth, apoptosis, proliferation, differentiation, migration (including cellular movement), and angiogenesis. They also play a crucial role in disease progression, invasion, and metastasis. Specifically, miR-193a-5p, a member of the miR-193a family, is instrumental in the development of various malignancies, including osteosarcoma, hepatocellular carcinoma, cervical cancer, melanoma, gastrointestinal cancer, lung cancer, prostate cancer, and bladder cancer. Studies have revealed that miR-193a-5p (sequence: UGGGUCUUUGCGGGCGAGAUGA; accession number: MIMAT0004614) is downregulated in numerous cancer cell lines and clinical samples. Furthermore, the tumor-suppressive effects of miR-193a-5p have been corroborated in animal models across different cancer types. These studies suggest that overexpression of this miRNA or modulation of lncRNA expression can inhibit oncogenesis. In this review, we summarize the functions of miR-193a-5p in cancer development.
Indexed as
Identifiers
What Socratic holds
Registered trials
Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the Socratic graph.