Evidence map›Paper›PMID 40161373›Full record

ReviewFrontiers in oncology2025

A review on the role of MiR-193a-5p in oncogenesis and tumor progression.

Weixiang Tang, Yuhua Rao, Longsheng Pi, Jinping Li

Abstract readReview
In one paragraph

Review in Frontiers in oncology, 2025. The graph could read no effect estimate from its abstract, so it casts no vote on the map. Cited by 9 papers.

0numbers the graph read from it
0cells of the map it votes in
9citing papers in PubMed
–field-weighted citation impact
1 · What the graph read from it

What it found

Each row is one number read from the abstract, on the scale the paper reported it, with its interval. Left of the dashed line favours the treatment, right favours the comparator. Under each row is the sentence it came from. New to these charts? A ten-minute tutorial.

The abstract states no effect estimate the extractor could read, or names no intervention and outcome on the map, so this paper lights no cell and moves no belief. It is still indexed, cited and linked below.

2 · The registry

The trial behind it

Trials whose registry record cites this paper, or whose number appears in the abstract. A trial that started after this paper was published is citing it as background, not reporting it.

Neither the registry nor the abstract names a trial number. If this is a trial report, that itself is worth knowing.

3 · Its place in the literature

Who cites it

9 citing papers in PubMed.

  1. Article
  2. Article
  3. Article
  4. Epigenetics in B-CLL.International journal of genomics · 2026
    Review
  5. Article
  6. Article
  7. Article
  8. Article
  9. Article
4 · The record

Corrections and comments

PubMed lists nothing against this paper. Absence here is not a guarantee, only a check that was made.

5 · Who and what money

Authors and funding

4 authors.

Weixiang TangDepartment of Orthopaedics, Changsha Central Hospital (The Affiliated Changsha Central Hospital, Hengyang Medical School, University of South China), Changsha, Hunan, China.
Yuhua RaoDepartment of Orthopaedics, Changsha Central Hospital (The Affiliated Changsha Central Hospital, Hengyang Medical School, University of South China), Changsha, Hunan, China.
Longsheng PiDepartment of Orthopaedics, Changsha Central Hospital (The Affiliated Changsha Central Hospital, Hengyang Medical School, University of South China), Changsha, Hunan, China.
Jinping LiDepartment of Orthopaedics, Changsha Central Hospital (The Affiliated Changsha Central Hospital, Hengyang Medical School, University of South China), Changsha, Hunan, China.

Funding

No grant is acknowledged in the PubMed record.

6 · The paper itself

Abstract

MicroRNA (miRNA), a class of short non-coding RNA molecules comprising 18-25 nucleotides, are pivotal regulators of gene expression within physiological environments, influencing processes such as cell growth, apoptosis, proliferation, differentiation, migration (including cellular movement), and angiogenesis. They also play a crucial role in disease progression, invasion, and metastasis. Specifically, miR-193a-5p, a member of the miR-193a family, is instrumental in the development of various malignancies, including osteosarcoma, hepatocellular carcinoma, cervical cancer, melanoma, gastrointestinal cancer, lung cancer, prostate cancer, and bladder cancer. Studies have revealed that miR-193a-5p (sequence: UGGGUCUUUGCGGGCGAGAUGA; accession number: MIMAT0004614) is downregulated in numerous cancer cell lines and clinical samples. Furthermore, the tumor-suppressive effects of miR-193a-5p have been corroborated in animal models across different cancer types. These studies suggest that overexpression of this miRNA or modulation of lncRNA expression can inhibit oncogenesis. In this review, we summarize the functions of miR-193a-5p in cancer development.

Indexed as

cancerexpressionmalignanciesmiR-193a-5pmodulationoncogenesis

Identifiers

PMID40161373
PMCPMC11949885

What Socratic holds

Textmetadata
LicenceCC BY
Read underepoch 390

Registered trials

None linked

Read under generation 80e0d062 · epoch 390. Bibliography from PubMed, PubMed Central and OpenAlex; grants from NIH RePORTER; trial links from ClinicalTrials.gov; estimates, votes and beliefs from the Socratic graph.